umuc-biol320-quiz-1-latest-2015-winters-code

Share on facebook
Facebook
Share on google
Google+
Share on twitter
Twitter
Share on linkedin
LinkedIn

BIOL 320

Quiz #1

1. The
scientific method comes in various forms.
The book shows one version, and in my lecture notes, I presented another
version. Despite variations, the core
elements are always present. Which of
the following would not be considered a core element of the scientific method?

a. observation

b. hypothesis

c. question

d, experiment

e. conclusion

2. Fill in the blank: Mitosis results in _______2___ daughter cells and meiosis results in

____4_____ daughter cells.

3.What is the
difference between the cause and manner of death?

a.
The cause of death is the biological reason for the cessation of life
while the manner of death is the way death occurred.

b.
The cause of death is the way death occurred and the manner of death is
the biological reason for life cessation.

c.
The cause of death is a doctors term and is no different from the
coroners term of manner of death.

d.
The term cause of death is used in hospital autopsy and manner of death
in medico-legal autopsy.

4. Which of the following does not belong?

a.
homicide

b.
drug overdose

c.
suicide

d.
natural

e.
accidental

5. Which of the following is incorrectly matched? (multiple select)

a.
livor mortis: post-mortem cooling

b.
rigor mortis: muscle stiffening

c.
algor mortis: post mortem blood
settling

d.
petechiae: pin point hemorrhages

6. True or False: Petechiae are a
conclusive way to determine death by hanging or strangulation.

7. Transcribe the following DNA template strand into mRNA:

AAGTACGTAAGCTGGATATT

8. True or False. An autopsy is
required if a firefighter dies in the line of duty in Maryland.

9. Which of the following components is most
commonly tested for in forensic laboratories today to indicate the presence of
fecal matter?

a. creatinine

b. amylase

c. urobilinogen

d. urea

10. True or False. Necrophagous means live-flesh eating.

11. What are the two types of amylase? How do they differ?

Amy 1 “salivary locus “responsible for
amylase detected in saliva, sweat, nasal secretions, breast milk. Amy2 on the
other hand “pancreatic locus”. It is responsible for amylase detected in semen,
blood, urine feces, and
vaginal fluid.

12. A
positive result with the Jaffe Reaction turns deep orange colo

13. What are the main components of a sperm cell?

Head, neck, acrosome, nucleus, mid-piece, and
tail.

14. True or False. A presumptive test can definitively identify
a biological fluid.

15. Name a confirmatory test for blood.

Crystalline test

16. Submit to your assignments folder with your
name in the filename.

More to explorer

Change Management Presentation

Purpose of AssessmentDevelop specific strategies with supporting tactics to implement positive change within an organization. You may refer to the information that you

Driver Safety

 You were recently hired as the fleet safety manager of a company that operates a fleet of 25 delivery trucks within a

Answer:

Title: umuc-biol320-quiz-1-latest-2015-winters-code

This question has been Solved!

Click the button below to order this solution.

Leave a Reply

Your email address will not be published. Required fields are marked *

Open chat